Multidrug-resistant Mycobacterium Tuberculosis Isolates Research Articles

Transmission of drug-resistant Mycobacterium tuberculosis isolates between Finnish- and foreign-born cases, 2014–2021: A molecular epidemiological study

BackgroundData on the molecular epidemiology and transmission of drug-resistant Mycobacterium tuberculosis (MTB) in low-incidence settings with immigration from high-incidence settings is limited. MethodWe included 115 drug-resistant (DR) MTB isolates with whole-genome sequencing data isolated in Finland between 2014 and 2021. Potential transmission clusters were identified using a threshold of 12 single-nucleotide polymorphisms (SNPs). Highly related clusters were identified using a threshold of 5 SNPs. ResultOf the 115 DR MTB isolates, 31 (27.0%) isolates were from Finnish-born cases and 84 (73.0%) were from foreign-born cases. The proportion of multidrug-resistant (MDR) MTB isolates (30/84, 35.7%) from foreign-born cases was higher than that of MDR MTB isolates from Finnish-born cases (8/31, 25.8%). Lineage 2 (40/115, 34.8%) and lineage 4 (40/115, 34.8%) were the most prevalent lineages. A total of 25 (21.7%) isolates were classified into eight potential transmission clusters (≤12 SNPs). Furthermore, five highly related clusters (≤5 SNPs) were identified, including three DR MTB isolates from Finnish-born cases and 14 DR isolates from foreign-born cases. ConclusionThe risk of DR MTB transmission between Finnish- and foreign-born persons is not negligible. Further research on clustering analysis in drug-susceptible MTB is worth to inform tuberculosis management and control in low-incidence settings with increasing immigration.

Prevalence, Transmission and Genetic Diversity of Pyrazinamide Resistance Among Multidrug-Resistant Mycobacterium tuberculosis Isolates in Hunan, China.

China is a country with a burden of high rates of both TB and multidrug-resistant TB (MDR-TB). However, published data on pyrazinamide (PZA) resistance are still limited in Hunan province, China. This study investigated the prevalence, transmission, and genetic diversity of PZA resistance among multidrug-resistant Mycobacterium tuberculosis isolates in Hunan province. Drug susceptibility testing (DST) with the Bactec MGIT 960 PZA kit and pyrazinamidase (PZase) testing were conducted on all 298 MDR clinical isolates. Moreover, 24-locus MIRU-VNTR and DNA sequencing of pncA, rpsA, and panD genes were conducted on 180 PZA-resistant (PZA-R) isolates. The prevalence of PZA resistance among MDR-TB strains reached 60.4%. Newly diagnosed PZA-R TB patients and clustered isolates with identical pncA, rpsA, and panD mutations showed that transmission of PZA-R isolates played a significant role in the formation of PZA-R TB. Ninety-eight mutation patterns were observed in the pncA among 180 PZA-R isolates, and seventy-one (72.4%) were point mutations. Twenty-four of these mutations are new, including 2 base substitutions (V93G and T153S) and 22 nucleotide deletions or insertions. The W119C was found in PZA-S isolates, on the other hand, F94L and V155A mutations were found in both PZA resistant and susceptible isolates with positive PZase activity, indicating that they were not associated with PZA resistance. This is not entirely in line with the WHO catalogue. Ten novel rpsA mutations were found in 10 PZA-R isolates, which all combined with mutations in pncA. Thus, it is unpredictable whether these mutations in rpsA can impact PZA resistance. No panD mutation was found in all PZA-R isolates. DNA sequencing of pncA and PZase activity testing have great potential in predicting PZA resistance.

Association of Mutations in gyrA Gene with Resistance to Fluoroquinolones in Clinical Isolates of Multidrug-Resistant Mycobacterium tuberculosis

Association of Mutations in gyrA Gene with Resistance to Fluoroquinolones in Clinical Isolates of Multidrug-Resistant Mycobacterium tuberculosis

Genotypic and phenotypic comparison of drug resistance profiles of clinical multidrug-resistant Mycobacterium tuberculosis isolates using whole genome sequencing in Latvia

BackgroundMultidrug-resistant tuberculosis (MDR–TB) remains a major public health problem in many high tuberculosis (TB) burden countries. Phenotypic drug susceptibility testing (DST) take several weeks or months to result, but line probe assays and Xpert/Rif Ultra assay detect a limited number of resistance conferring gene mutations. Whole genome sequencing (WGS) is an advanced molecular testing method which theoretically can predict the resistance of M. tuberculosis (Mtb) isolates to all anti-TB agents through a single analysis.MethodsHere, we aimed to identify the level of concordance between the phenotypic and WGS-based genotypic drug susceptibility (DS) patterns of MDR–TB isolates. Overall, data for 12 anti-TB medications were analyzed.ResultsIn total, 63 MDR–TB Mtb isolates were included in the analysis, representing 27.4% of the total number of MDR–TB cases in Latvia in 2012–2014. Among them, five different sublineages were detected, and 2.2.1 (Beijing group) and 4.3.3 (Latin American-Mediterranean group) were the most abundant. There were 100% agreement between phenotypic and genotypic DS pattern for isoniazid, rifampicin, and linezolid. High concordance rate (> 90%) between phenotypic and genotypic DST results was detected for ofloxacin (93.7%), pyrazinamide (93.7%) and streptomycin (95.4%). Phenotypic and genotypic DS patterns were poorly correlated for ethionamide (agreement 56.4%), ethambutol (85.7%), amikacin (82.5%), capreomycin (81.0%), kanamycin (85.4%), and moxifloxacin (77.8%). For capreomycin, resistance conferring mutations were not identified in several phenotypically resistant isolates, and, in contrary, for ethionamide, ethambutol, amikacin, kanamycin, and moxifloxacin the resistance-related mutations were identified in several phenotypically sensitive isolates.ConclusionsWGS is a valuable tool for rapid genotypic DST for all anti-TB agents. For isoniazid and rifampicin phenotypic DST potentially can be replaced by genotypic DST based on 100% agreement between the tests. However, discrepant results for other anti-TB agents limit their prescription based solely on WGS data. For clinical decision, at the current level of knowledge, there is a need for combination of genotypic DST with modern, validated phenotypic DST methodologies for those medications which did not showed 100% agreement between the methods.

Association of Mutations in gyrA Gene with Resistance to Fluoroquinolones in Clinical Isolates of Multidrug-Resistant Mycobacterium tuberculosis

Association of Mutations in gyrA Gene with Resistance to Fluoroquinolones in Clinical Isolates of Multidrug-Resistant Mycobacterium tuberculosis

Metabolic Profiles of Clinical Isolates of Drug-Susceptible and Multidrug-Resistant Mycobacterium tuberculosis: A Metabolomics-Based Study.

Mycobacterium tuberculosis (MTB) is a global and highly deleterious pathogen that creates an enormous pressure on global public health. Although several effective drugs have been used to treat tuberculosis, the emergence of multidrug-resistant Mycobacterium tuberculosis (MDR-MTB) has further increased the public health burden. The aim of this study was to describe in depth the metabolic changes in clinical isolates of drug-susceptible Mycobacterium tuberculosis (DS-MTB) and MDR-MTB and to provide clues to the mechanisms of drug resistance based on metabolic pathways. Based on the minimum inhibition concentration (MIC) of multiple anti-tuberculosis drugs, two clinical isolates were selected, one DS-MTB isolate (isoniazid MIC=0.06 mg/L, rifampin MIC=0.25 mg/L) and one MDR-MTB isolate (isoniazid MIC=4 mg/L, rifampin MIC=8 mg/L). Through high-throughput metabolomics, the metabolic profiles of the DS-MTB isolate and the MDR-MTB isolate and their cultured supernatants were revealed. Compared with the DS-MTB isolate, 128 metabolites were significantly altered in the MDR-MTB isolate and 66 metabolites were significantly altered in the cultured supernatant. The differential metabolites were significantly enriched in pyrimidine metabolism, purine metabolism, nicotinate and nicotinamide metabolism, arginine acid metabolism, and phenylalanine metabolism. Furthermore, metabolomics analysis of the bacterial cultured supernatants showed a significant increase in 10 amino acids (L-citrulline, L-glutamic acid, L-aspartic acid, L-norleucine, L-phenylalanine, L-methionine, L-tyrosine, D-tryptophan, valylproline, and D-methionine) and a significant decrease in 2 amino acids (L-lysine and L-arginine) in MDR-MTB isolate. The present study provided a metabolite alteration profile as well as a cultured supernatant metabolite alteration profile of MDR-MTB clinical isolate, providing clues to the potential metabolic pathways and mechanisms of multidrug resistance.

Phylogenetic relationships of Mycobacterium tuberculosis isolates in Poland: The emergence of Beijing genotype among multidrug-resistant cases.

The epidemiological situation of tuberculosis (TB) in Poland urges for its continuous and scrupulous monitoring. The objective of this study was to explore the genetic diversity of multidrug-resistant (MDR) and drug-susceptible (DS) Mycobacterium tuberculosis isolates from Poland with a combination of spoligotyping and high-resolution mycobacterial interspersed repetitive unit-variable number tandem repeat (MIRU-VNTR) analysis. The results were placed in the Northern and Eastern Europe context. The study included 89 (39 MDR and 50 DS) M. tuberculosis isolates collected from as many patients between 2018 and 2021 in Poland. The analysis was done using spoligotyping, and MIRU-VNTR typing at 24 standard loci. The data were compared to those available on Poland and neighbors and global M. tuberculosis datasets. The main identified families were Beijing (28.1%) and Haarlem (16.8%) while 34.8% of isolates were in the heterogeneous L4-unclassified group. Although the Beijing family was the most prevalent (61.5%) among MDR-TB cases, it accounted for only 2% of DS isolates. Among foreign-born patients, a higher ratio of MDR isolates were observed when compared with those who Poland-born (64.3% vs. 40%). Furthermore, all patients from the Former Soviet Union (FSU) countries were infected with MDR-TB. Whereas DS M. tuberculosis population in Poland is dominated by L4 isolates, MDR isolates are mostly of the Beijing genotype. The rise in the prevalence of the Beijing isolates in Poland, coupled with high proportion of the Beijing genotype among foreign-born TB patients may reflect an ongoing transmission of this family, imported to Poland mainly from FSU countries.

In vitro activity of tetracycline analogs against multidrug-resistant and extensive drug resistance clinical isolates of Mycobacterium tuberculosis

BackgroundMultidrug-resistant tuberculosis (MDR-TB) has become a big threaten to global health. The current strategy for treatment of MDR-TB and extensive drug resistant tuberculosis (XDR-TB) is with low efficacy and high side effect. While new drug is fundamental for cure MDR-TB, repurposing the Food and Drug Administration (FDA)-approved drugs represents an alternative soluation with less cost. MethodsThe activity of 8 tetracycline-class antibiotics against mycobacterium tuberculosis (M.tb) were determined by Minimum Inhibitory Concentration (MIC) in vitro. A transposon M.smeg libraries was generated by using the Harm phage and then used to isolate the conditional growth mutants in doxycycline containing plate. Eleven mutants were isolated and genomic DNAs were extracted using the cetyltrimethyl ammonium bromide (CTAB) method and analyzed by whole genome sequencing. ResultsWe found that three of eight drugs efficiently inhibited mycobacteria growth under the peak plasma concentration in the human body. Further tests showed these three tetracycline analogs (demeclocycline, doxycycline and methacycline) had antimicrobial activity against seven clinical isolates, including MDR and XDR strains. Among them, Doxycycline had the lowest MICs in all mycobacteria strains tested in this study. By using a transposon library, we identify the insertion of transposon in two genes, porin and MshA, associatewith the resistant to doxycycline. ConclusionsOur findings show that tetracycline analogs such as doxycycline, has bactericidal activity against not only drug sensitive M.tb, but also clinical MDR and XDR strains, provided proof of concept to repurpose doxycycline to fight MDR-TB and XDR-TB. Further investigations are warranted to clarify the underlying mechanism and optimize the strategy in combination with other anti-TB drugs.

Molecular Characterization of Resistance to Second-Line Anti-Mycobacterial Drugs among Clinical Isolates of Multidrug-Resistant Mycobacterium tuberculosis

The emergence of multidrug resistance and extensively drug-resistant tuberculosis is a serious public health crisis. Using rapid and inexpensive molecular methods such as HRM assay in the detection of second-line drugs resistance in M. tuberculosis would be helpful in the treatment and control of XDR tuberculosis cases. MDR-TB isolates were collected from Iranian tuberculosis laboratories. Drug susceptibility test performed via the indirect proportion method utilizing LJ Medium. Susceptibility to ciprofloxacin, ofloxacin, amikacin, kanamycin, and capreomycin, as second-line anti-tuberculosis agents were assessed. Single point mutations in gyrA, rrs and eis genes were detected via HRM assay and DNA sequencing. A DST test was performed for 56 MDR isolates and at least 27 (48.2%) isolates were resistant to CIP or OFL. Also, 14 (25%), 12 (21.4%), and 15 (26.7%) isolates were resistant to capreomycin, amikacin, and kanamycin, respectively. D94G, A90V, and G88C mutations were the most frequent mutations in gyrA gene. Also, A1401G mutation was detected more than the other mutations in rrs gene. The frequency of CIP/OFL and AMK/CAP/KAN-resistant TB is considerable among Iranian tuberculosis cases. HRM assay is a rapid and inexpensive test and can detect important mutation-based drug resistance in MDR-TB and XDR-TB isolates.

Genotypic Distribution and the Epidemiology of Multidrug Resistant Tuberculosis in Upper Northern Thailand.

The epidemiology and genotypes of multidrug-resistant tuberculosis (MDR-TB), a global public health threat, remain limited. The genotypic distribution and factors associated with MDR-TB in upper northern Thailand between 2015 and 2019 were investigated. The DNA sequencing of rpoB, katG, and inhA promoter of 51 multidrug-resistant Mycobacterium tuberculosis isolates revealed nine patterns of the rpoB gene mutation distributed in seven provinces. The S531L mutation was the most common mutation in all provinces. The rpoB mutation in Chiang Rai, Chiang Mai, and Lampang was highly diverse compared to other areas. Here, the mutation profiles that have yet to be reported in northern Thailand (H526P, Q513P, and H526C) were detected in Chiang Rai province. The S315T katG mutation was the most common genotype associated with INH resistance, especially in Chiang Mai and Lampang. Further analysis of data from 110 TB patients (42 MDR-TB and 68 drug-susceptible TB) revealed that <60 years of age was a significant factor associated with MDR-TB (OR = 0.316, 95% CI 0.128-0.784, p = 0.011) and ≥60 years of age was a significant factor associated with the S315T katG-mutation (OR = 8.867, 95% CI 0.981-80.177, p = 0.047). This study highlighted the necessity for continuous surveillance and risk factor monitoring for effective control of MDR-TB.

Novel oxazolidinones harbor potent in vitro activity against the clinical isolates of multidrug-resistant Mycobacterium tuberculosis in China.

To investigate the in vitro activities of five oxazolidinones in parallel against the reference strains of different mycobacterial species and clinical isolates of Mycobacterium tuberculosis (Mtb), and shed light on the differences in the efficacy of these homolog drugs. The minimum inhibitory concentrations (MICs) of linezolid, tedizolid, sutezolid, delpazolid, and contezolid against 16 mycobacterial reference strains and 69 M. tuberculosis clinical isolates, including 17 drug-susceptible isolates and 52 multidrug-resistant (MDR) isolates, were determined by microplate alamarBlue assay (MABA). The intracellular killing activities of contezolid and linezolid against Mtb H37Rv were compared. In addition, mutations in the linezolid resistance-related genes (rplC, rplD, and 23S rRNA) of the Mtb clinical isolates were also analyzed. Tedizolid exhibited the strongest inhibitory activities against the reference strains of both rapidly growing mycobacteria (RGM) and slowly growing mycobacteria (SGM), among the tested oxazolidinones. In contrast, sutezolid only manifested potent activity against reference strains of SGM. Linezolid, delpazolid, and contezolid were less active against the non-tuberculous mycobacterial references. For the Mtb clinical isolates, the antimicrobial action was ranked as: sutezolid > tedizolid > contezolid and linezolid > delpazolid, whereas no difference between drug-sensitive and multiple drug-resistant isolates was observed. Notably, contezolid demonstrated obviously superior intracellular antimicrobial activity than linezolid. Few strains harbored mutations in rrl gene or rplD genes, although these strains had drug susceptible profiles to linezolid. Different oxazolidinones can have discrepant antimicrobial activity against different mycobacterial species, or have different manifestations out of cell or in cell. Understanding these differences would be helpful in choosing the appropriate drug in clinical practice.

GenoType MTBDRsl for detection of second-line drugs and ethambutol resistance in multidrug-resistant Mycobacterium tuberculosis isolates at a high-throughput laboratory

We assessed the performance of MTBDRsl for detection of resistance to fluoroquinolones, aminoglycosides/cyclic peptides, and ethambutol compared to BACTEC MGIT 960 by subjecting simultaneously to both tests 385 phenotypically multidrug-resistant-Mycobacterium tuberculosis isolates from Sao Paulo, Brazil. Discordances were resolved by Sanger sequencing. MTBDRsl correctly detected 99.7% of the multidrug-resistant isolates, 87.8% of the pre-XDR, and 73.9% of the XDR. The assay showed sensitivity of 86.4%, 100%, 85.2% and 76.4% for fluoroquinolones, amikacin/kanamycin, capreomycin and ethambutol, respectively. Specificity was 100% for fluoroquinolones and aminoglycosides/cyclic peptides, and 93.6% for ethambutol. Most fluoroquinolone-discordances were due to mutations in genome regions not targeted by the MTBDRsl v. 1.0: gyrA_H70R and gyrB_R446C, D461N, D449V, and N488D. Capreomycin-resistant isolates with wild-type rrs results on MTBDRsl presented tlyA mutations. MTBDRsl presented good performance for detecting resistance to second-line drugs and ethambutol in clinical isolates. In our setting, multidrug-resistant. isolates presented mutations not targeted by the molecular assay.

Mutant vary region of pncA gene sequence of pyrazinamide resistance among multidrug resistant Mycobacterium tuberculosis isolates

ABSTRACT Introduction: Pyrazinamide (PZA) is one of the potent front-line drugs that act as antituberculosis (antiTB) for nonresistant or resistant Mycobacterium tuberculosis. Mutation of pncA gene is considered to be main target of PZA resistance mechanism. This study aims to determine the mutant gene sequences, location, and correlation of pncA gene mutations with PZA resistance in MDR Mycobacterium tuberculosis as a base for the rapid molecular examination. Objective: This study aims to determine the mutant gene sequence and location of pncA gene with PZA resistance in multidrug resistant (MDR) Mycobacterium tuberculosis need a rapid molecular examination for consideration of MDR TB therapy management in Indonesia. Methods: MDR Mycobacterium tuberculosis were identified and tested for PZA resistance with BACTEC MGIT 960 as a gold standard, followed by DNA extraction, PCR amplification and pncA gene sequencing. Results: An analysis of 561 bp sequence of nucleotides was performed to determine type and location of mutations. A total of 35 isolates of this study showed 14 isolates of pncA gene mutation (40%), and revealed in 13 resistant and 1 sensitive isolate. The correlation analysis of pncA gene mutation to PZA resistance was significant (p = 0,003 and r = 0,452). Mutations in 3 (three) specific regions of pncA gene are 1 isolate at codons 51-76, 1 isolate at codons 130-142, and 3 isolates at codons 163-180. Conclusion: Types of mutations in the pncA gene include substitution of 11 isolates, insertion of 2 isolates, and no deletion. Insertion of 178 CGCGCTGGAGGAGATGCGCACCGCC and multiple mutations in one isolate.

Prediction of drug resistance profile of multidrug-resistant Mycobacterium tuberculosis (MDR-MTB) isolates from newly diagnosed case by whole genome sequencing (WGS): a study from a high tuberculosis burden country

ObjectivesOur aim was to assess the ability of the Whole-genome sequencing (WGS) in predicting drug resistance profile of multidrug-resistant mycobacterium tuberculosis (MDR-MTB) from newly diagnosed cases in China.MethodsWe validated the Phenotypic drug Sensitivity Test (pDST) for 12 anti-tuberculosis drugs using the Bactec MGIT 960 system. We described the characteristics of the isolates enrolled and compared the pDST results with resistance profiles predicted by WGS.ResultsThe pDST showed that of the 43 isolates enrolled, 25.6% were sensitive to rifabutin (RFB); 97.7%、97.7%、93.0% and 93.0% were sensitive to cycloserine (Cs), amikacin/kanamycin (Ak/Km), para-aminosalicylic acid (Pas) and ethionamide Eto), respectively; 18.6% were resistant to fluoroquinolones (FQs) or second-line injections. Genotype DST determined by WGS of Ak/Km、Eto and RFP reached high consistency to 97.7% compared with pDST, followed by moxifloxacin (Mfx) 95.3%, levofloxaci (Lfx) and Pas 93%, streptomycin (Sm) 90.3%. The genotype DST of RFB and EMB showed low consistency with the pDST of 67.2 and 79.1%. WGS also detected 27.9% isolates of pyrazinamide(PZA)-related drug-resistant mutation. No mutations associated with linezolid (Lzd), bedaquiline (Bdq) and clofazimine (Cfz) were detectd.ConclusionsWGS has the potential to infer resistance profiles without time-consuming phenotypic methods, which could be provide a basis to formulate reasonable treatment in high TB burden areas.

Whole genome sequencing of multidrug-resistant Mycobacterium tuberculosis isolates collected in the Czech Republic, 2005\u20132020

The emergence and spread of resistant tuberculosis (TB) pose a threat to public health, so it is necessary to diagnose the drug-resistant forms in a clinically short time frame and closely monitor their transmission. In this study, we carried out a first whole genome sequencing (WGS)-based analysis of multidrug resistant (MDR) M. tuberculosis strains to explore the phylogenetic lineages diversity, drug resistance mechanisms, and ongoing transmission chains within the country. In total, 65 isolates phenotypically resistant to at least rifampicin and isoniazid collected in the Czech Republic in 2005–2020 were enrolled for further analysis. The agreement of the results obtained by WGS with phenotypic drug susceptibility testing (pDST) in the determination of resistance to isoniazid, rifampicin, pyrazinamide, streptomycin, second-line injectables and fluoroquinolones was more than 80%. Phylogenetic analysis of WGS data revealed that the majority of MDR M. tuberculosis isolates were the Beijing lineage 2.2.1 (n = 46/65; 70.8%), while the remaining strains belonged to Euro-American lineage. Cluster analysis with a predefined cut-off distance of less than 12 single nucleotide polymorphisms between isolates showed 19 isolates in 6 clusters (clustering rate 29.2%), located mainly in the region of the capital city of Prague. This study highlights the utility of WGS as a high-resolution approach in the diagnosis, characterization of resistance patterns, and molecular-epidemiological analysis of resistant TB in the country.

In vitro activity of tedizolid and linezolid against multidrug-resistant Mycobacterium tuberculosis: a comparative study using microdilution broth assay and genomics

The effects of tedizolid (TZD) against multidrug-resistant Mycobacterium tuberculosis isolates were investigated. This is possibly the first study to evaluate the MIC of TZD against Japanese Mycobacterium tuberculosis isolates. As TZD had a significantly lower MIC than LZD (P < 0.01), it was suggested to be a better, non-toxic alternative to LZD.

Whole genome sequencing-based drug resistance predictions of multidrug-resistant Mycobacterium tuberculosis isolates from Tanzania.

BackgroundRifampicin- or multidrug-resistant (RR/MDR) Mycobacterium tuberculosis complex (MTBC) strains account for considerable morbidity and mortality globally. WGS-based prediction of drug resistance may guide clinical decisions, especially for the design of RR/MDR-TB therapies.MethodsWe compared WGS-based drug resistance-predictive mutations for 42 MTBC isolates from MDR-TB patients in Tanzania with the MICs of 14 antibiotics measured in the Sensititre™ MycoTB assay. An isolate was phenotypically categorized as resistant if it had an MIC above the epidemiological-cut-off (ECOFF) value, or as susceptible if it had an MIC below or equal to the ECOFF.ResultsOverall, genotypically non-wild-type MTBC isolates with high-level resistance mutations (gNWT-R) correlated with isolates with MIC values above the ECOFF. For instance, the median MIC value (mg/L) for rifampicin-gNWT-R strains was >4.0 (IQR 4.0–4.0) compared with 0.5 (IQR 0.38–0.50) in genotypically wild-type (gWT-S, P < 0.001); isoniazid-gNWT-R >4.0 (IQR 2.0–4.0) compared with 0.25 (IQR 0.12–1.00) among gWT-S (P = 0.001); ethionamide-gNWT-R 15.0 (IQR 10.0–20.0) compared with 2.50 (IQR; 2.50–5.00) among gWT-S (P < 0.001). WGS correctly predicted resistance in 95% (36/38) and 100% (38/38) of the rifampicin-resistant isolates with ECOFFs >0.5 and >0.125 mg/L, respectively. No known resistance-conferring mutations were present in genes associated with resistance to fluoroquinolones, aminoglycosides, capreomycin, bedaquiline, delamanid, linezolid, clofazimine, cycloserine, or p-amino salicylic acid.ConclusionsWGS-based drug resistance prediction worked well to rule-in phenotypic drug resistance and the absence of second-line drug resistance-mediating mutations has the potential to guide the design of RR/MDR-TB regimens in the future.

Characterization of embB mutations involved in ethambutol resistance in multi-drug resistant Mycobacterium tuberculosis isolates in Zambia

BackgroundEthambutol (EMB) is an important anti-tuberculosis drug used in the management of multi-drug resistant tuberculosis (MDR-TB). Mutations in embB are the major mechanism of resistance. This study investigated embB mutations among MDR-TB isolates and analyzed their correlations with phenotypic drug susceptibility testing (DST) in Zambia. MethodA total of 132 MDR-TB isolates were collected from January 2014 to April 2017 and characterized using MGIT 960 systems, embB sequencing, and spoligotyping. ResultsOut of 61 phenotypically EMB resistant isolates, 53 had mutations in embB. Among the 71 EMB susceptible isolates, 47 had embB mutations. Sensitivity of embB mutations was 86.9% while specificity was 33.8%. CAS1_Kili (SIT21) had high odds of having embB mutations, particularly, G918A (Met306eIl) (Odds ratio 16.7, p < 0.0001). ConclusionMolecular EMB resistance testing by DNA sequencing can improve detection of EMB resistance among MDR-TB patients in Zambia. Additionally, CAS1_Kili was associated with embB amino acid substitution Met306Ile suggesting transmission. A detailed investigation to track and determine transmission hotspot area for MDR-TB could help optimize control strategies.

The evaluation of second line drug susceptibilities and molecular epidemiological profiles of multidrug resistance Mycobacterium tuberculosis isolates isoleted from different region of Turkey

Introduction: This study was planned to determine the second line drug resistance and molecular epidemiological profiles of multidrug resistant Mycobacterium tuberculosis isolates isolated from different geographical regions of Turkey.&#x0D; Material and Method: In our study, 63 MDR M. tuberculosis isolates were evaluated for the drug susceptibility sent from different tuberculosis laboratories of Turkey. Secondary antituberculosis drugs resistance was evaluated by indirect proportion method. Epidemiological origins were evaluated by using IS6110-RFLP and spoligotyping methods. &#x0D; Results: Cycloserine, ethionamide, capreomycin, thiacetozone, ofloxacin, kanamsin and paraaminosalicylic acid resistance rates were 15.87%, 19.04%, 7.93%, 6.34%, 11.11%, 12.69% and 6.34.%, respectively. According to spoligotyping results, 11 different patterns were obtained, including 52 isolates consisting of 5 clusters and 11 patterns consisting of a single isolate. When we compared our results with the spoligotype database in the world; 42 of 52 isolates forming 5 clusters were identified as predefined spoligotypes (LAM7-TUR, LAM9, T clade). 10 isolates showed the characteristics of the U spoligotype family. Of the 11 isolates that produced 11 different patterns, 8 were Haarlem and T spoligotypes. It was found that 2 isolates had the characteristics of Orphan and 1 isolate had the characteristics of BOV family. &#x0D; Conclusion: In our study, LAM7-TUR, LAM9, T clade spoligotype families are common in our country and in the world were determined.

Anti-Mycobacterial and Synergistic Activity of Synthetic Acridine-9-Carboraldehyde and 9-Hydroxy-4-Methoxy Acridine Alkaloids against Clinical Isolates of Multidrug-Resistant Mycobacterium Tuberculosis

Anti-Mycobacterial and Synergistic Activity of Synthetic Acridine-9-Carboraldehyde and 9-Hydroxy-4-Methoxy Acridine Alkaloids against Clinical Isolates of Multidrug-Resistant Mycobacterium Tuberculosis